Top » Catalog » SNPs » FGC19506

$18.00

FGC19506
[FGC19506]

FGC19506
hg38 Position: ChrY:21007415..21007415
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Attention: 96% similar to Chr7
Forward Primer: FGC19506_F AGCTTTGTCCTTTTGGCTTG
Reverse Primer: FGC19506_R GATACAAAATCAAAGTACAGAAATCGT
Reviews

Customers who bought this product also purchased
FGC7942
FGC7942
FGC4350
FGC4350
FGC4342
FGC4342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies