Top » Catalog » SNPs » YP4253

$18.00

YP4253
[YP4253]

YP4253
hg38 Position: ChrY:16300810..16300810
Ancestral: T
Derived: A
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a1a1b1a3a (not listed)
Comments: Downstream of YP4248
Forward Primer: YP4253_F CAGGCAACCTACATTTCTTTTACC
Reverse Primer: YP4253_R CCAACCAATTATGATTCCAAGC
Reviews

Customers who bought this product also purchased
L448
L448
YP355
YP355
YP618
YP618
YP5598
YP5598
R1a-Z284 Panel
R1a-Z284 Panel
YP4248
YP4248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies