Top » Catalog » SNPs » S11515

$18.00

S11515
[S11515]

S11515
hg38 Position: ChrY:8605068..8605068
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: S11515_F GGAGGCAGTGAGGTCAAGAG
Reverse Primer: S11515_R TGGTCCCCTGACACTAGCTC
Reviews

Customers who bought this product also purchased
BY128969
BY128969
FGC23212
FGC23212
A14207
A14207
A993
A993
BY12505
BY12505
S1812
S1812
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies