Top » Catalog » SNPs » CTS3386

$18.00

CTS3386
[CTS3386]

CTS3386
hg38 Position: ChrY:12773240..12773240
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3386_F CAGAGTGGGTGGAAGAGTGC
Reverse Primer: CTS3386_R CAACTTTGCTGGGTGATGTG
Reviews

Customers who bought this product also purchased
A67
A67
FGC3197
FGC3197
S3058
S3058
S425
S425
FGC18205
FGC18205
Z36747
Z36747
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19688
$18.00
Haplogroup Info
Other products
Currencies