Top » Catalog » SNPs » CTS3386

$18.00

CTS3386
[CTS3386]

CTS3386
hg38 Position: ChrY:12773240..12773240
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3386_F CAGAGTGGGTGGAAGAGTGC
Reverse Primer: CTS3386_R CAACTTTGCTGGGTGATGTG
Reviews

Customers who bought this product also purchased
FGC3213
FGC3213
Z18000
Z18000
R1b-DF21 Panel
R1b-DF21 Panel
S971
S971
Z29552
Z29552
A67
A67
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies