Top » Catalog » SNPs » CTS3386

$18.00

CTS3386
[CTS3386]

CTS3386
hg38 Position: ChrY:12773240..12773240
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3386_F CAGAGTGGGTGGAAGAGTGC
Reverse Primer: CTS3386_R CAACTTTGCTGGGTGATGTG
Reviews

Customers who bought this product also purchased
A2121
A2121
A194
A194
S1090
S1090
S1105
S1105
BY203693
BY203693
S1088
S1088
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies