Top » Catalog » SNPs » S1115

$18.00

S1115
[S1115]

S1115
hg38 Position: ChrY:7310280..7310280
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1
Comments: Below CTS4466
Forward Primer: S1115_F GACGCCCTGCACACTGTAG
Reverse Primer: S1115_R GCTCAATGTTTTCCCATAACG
Reviews

Customers who bought this product also purchased
A12386
A12386
BY23383
BY23383
FGC11304
FGC11304
FGC11272
FGC11272
FGC65810
FGC65810
BY11096
BY11096
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies