Top » Catalog » SNPs » FGC10125

$18.00

FGC10125
[FGC10125]

FGC10125
HG19 Position: ChrY:18047276..18047276
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments:
Forward Primer: FGC10125_F CCCAGGTATTTGGGTTCAAG
Reverse Primer: FGC10125_R TGTTAGAAGGGTGTGGTGGAG
Reviews (2)

Customers who bought this product also purchased
DF13
DF13
S1051
S1051
PH367
PH367
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
Z251
Z251
A5919
A5919
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies