Top » Catalog » SNPs » FGC10125

$18.00

FGC10125
[FGC10125]

FGC10125
HG19 Position: ChrY:18047276..18047276
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments:
Forward Primer: FGC10125_F CCCAGGTATTTGGGTTCAAG
Reverse Primer: FGC10125_R TGTTAGAAGGGTGTGGTGGAG
Reviews (2)

Customers who bought this product also purchased
Z251
Z251
A5919
A5919
DF41
DF41
Z16500
Z16500
Z39589
Z39589
S1026
S1026
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies