Top » Catalog » SNPs » FGC10125

$18.00

FGC10125
[FGC10125]

FGC10125
hg38 Position: ChrY:15935396..15935396
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1c
Comments: .
Forward Primer: FGC10125_F CCCAGGTATTTGGGTTCAAG
Reverse Primer: FGC10125_R TGTTAGAAGGGTGTGGTGGAG
Reviews (2)

Customers who bought this product also purchased
S1026
S1026
DF49
DF49
CTS1751
CTS1751
DF13
DF13
S1051
S1051
PH367
PH367
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies