Top » Catalog » SNPs » FGC12948

$18.00

FGC12948
[FGC12948]

FGC12948
hg38 Position: ChrY:20438385..20438385
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1b2
Comments: Downstream FGC4087
Forward Primer: FGC12948_F GCGTTTGACTTTACAGTCAAACTTTC
Reverse Primer: FGC12948_R CTGTTTATCATAGTTGGAGATCATTGAG
Reviews

Customers who bought this product also purchased
DF85
DF85
DF21
DF21
L21
L21
A259
A259
DF13
DF13
A223
A223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies