Top » Catalog » SNPs » DF63

$18.00

DF63
[DF63]

DF63
hg38 Position: ChrY:3015945..3015945
Ancestral: T
Derived: C
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c2
Comments: Downstream R-L21
Forward Primer: DF63_F CATTGATTTACATACCTGCTGTCAC
Reverse Primer: DF63_R CCCAAAGTTATTTATAGATTCAATGCTG
Reviews

Customers who bought this product also purchased
U175
U175
M343
M343
Z1788
Z1788
M201
M201
V22
V22
Z1720
Z1720
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies