Top » Catalog » SNPs » DF63

$18.00

DF63
[DF63]

DF63
hg38 Position: ChrY:3015945..3015945
Ancestral: T
Derived: C
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c2
Comments: Downstream R-L21
Forward Primer: DF63_F CATTGATTTACATACCTGCTGTCAC
Reverse Primer: DF63_R CCCAAAGTTATTTATAGATTCAATGCTG
Reviews

Customers who bought this product also purchased
R1b-DF27 Panel
R1b-DF27 Panel
Z17969
Z17969
FGC10059
FGC10059
A7907
A7907
DF27
DF27
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies