Top » Catalog » SNPs » A7626

$18.00

A7626
[A7626]

A7626
hg38 Position: ChrY:8221176..8221176
Ancestral: A
Derived: G
Reference: Charles Thornton (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508
Forward Primer: A7626_F GAACAGGCAAGGCATTGG
Reverse Primer: A7626_R CCTGTATTTATTCTTTATTTTTAAGGACAAGT
Reviews

Customers who bought this product also purchased
S7660
S7660
FGC35957
FGC35957
FGC22112
FGC22112
FGC14507
FGC14507
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
FGC35955
FGC35955
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies