Top » Catalog » SNPs » A7626

$18.00

A7626
[A7626]

A7626
hg38 Position: ChrY:8221176..8221176
Ancestral: A
Derived: G
Reference: Charles Thornton (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508
Forward Primer: A7626_F GAACAGGCAAGGCATTGG
Reverse Primer: A7626_R CCTGTATTTATTCTTTATTTTTAAGGACAAGT
Reviews

Customers who bought this product also purchased
FGC17110
FGC17110
FGC22110
FGC22110
FGC35957
FGC35957
S7660
S7660
FGC22112
FGC22112
FGC14507
FGC14507
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies