Top » Catalog » SNPs » A7626

$18.00

A7626
[A7626]

A7626
hg38 Position: ChrY:8221176..8221176
Ancestral: A
Derived: G
Reference: Charles Thornton (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508
Forward Primer: A7626_F GAACAGGCAAGGCATTGG
Reverse Primer: A7626_R CCTGTATTTATTCTTTATTTTTAAGGACAAGT
Reviews

Customers who bought this product also purchased
FGC23547
FGC23547
FGC22113
FGC22113
FGC14515
FGC14515
FGC35958
FGC35958
FGC17110
FGC17110
FGC22110
FGC22110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies