Top » Catalog » SNPs » A7627

$18.00

A7627
[A7627]

A7627
hg38 Position: ChrY:12021071..12021071
Ancestral: G
Derived: A
Reference: Charles Thornton (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508
Forward Primer: A7627_F CATTTACTTGACCTGCAACATCA
Reverse Primer: A7627_R GGTATAGTAGGATAATACAGCGCCTC
Reviews

Customers who bought this product also purchased
FGC22112
FGC22112
FGC14507
FGC14507
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
FGC35955
FGC35955
FGC23560
FGC23560
Y33772
Y33772
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies