Top » Catalog » SNPs » FT71088

$18.00

FT71088
[FT71088]

FT71088
hg38 Position: ChrY:15938593..15938593
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below Z643 > ZS1297 > ZS1296
Forward Primer: FT71088_F GTGAGATCTGGGGTGATTCATAC
Reverse Primer: FT71088_R GTTTGAGACAAGTCTGAGCAAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies