Top » Catalog » SNPs » BY167936

$18.00

BY167936
[BY167936]

BY167936
hg38 Position: ChrY:16673603..16673603
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below DF49 > DF104 > V86
Forward Primer: BY167936_F CCACTATCTTGCAGCCACTCTG
Reverse Primer: BY167936_R ATCCATCATTTCAAATTGTAAAACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies