Top » Catalog » SNPs » A7628

$18.00

A7628
[A7628]

A7628
hg38 Position: ChrY:12161354..12161354
Ancestral: G
Derived: T
Reference: Charles Thornton (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508
Forward Primer: A7628_F TGTGCAAAGCTACCATCATCTG
Reverse Primer: A7628_R GATGAGCGTGGGAGTTGG
Reviews

Customers who bought this product also purchased
FGC14515
FGC14515
FGC35958
FGC35958
FGC17110
FGC17110
FGC22110
FGC22110
S7660
S7660
FGC35957
FGC35957
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies