Top » Catalog » SNPs » A7628

$18.00

A7628
[A7628]

A7628
hg38 Position: ChrY:12161354..12161354
Ancestral: G
Derived: T
Reference: Charles Thornton (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508
Forward Primer: A7628_F TGTGCAAAGCTACCATCATCTG
Reverse Primer: A7628_R GATGAGCGTGGGAGTTGG
Reviews

Customers who bought this product also purchased
FGC23548
FGC23548
FGC22115
FGC22115
FGC14508
FGC14508
FGC35959
FGC35959
FGC23547
FGC23547
FGC22113
FGC22113
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies