Top » Catalog » SNPs » Y220386

$18.00

Y220386
[Y220386]

Y220386
hg38 Position: ChrY:14864047..14864047
Ancestral: G
Derived: A
Reference: YFull (2020)
ISOGG Haplogroup: I2
Comments: Below L621 > CTS10228 > PH908 > Y52621
Forward Primer: Y220386_F CACCAAGGGGACCTAATAGATG
Reverse Primer: Y220386_R TCTTCTCTCTTTTTTTCTTTTTTAGTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies