Top » Catalog » SNPs » Y56311

$18.00

Y56311
[Y56311]

Y56311
hg38 Position: ChrY:19029691..19029691
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a
Comments: Below Z93 > BY30941
Forward Primer: Y56311_F CCTCATTGAATTGTCATCGC
Reverse Primer: Y56311_R GGATATTTGGGTTACATCTAAGTTTTATCTAG
Reviews

Customers who bought this product also purchased
L657
L657
Y20787
Y20787
Y34305
Y34305
Z2124
Z2124
YP1506
YP1506
YP1451
YP1451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies