Top » Catalog » SNPs » Y56311

$18.00

Y56311
[Y56311]

Y56311
hg38 Position: ChrY:19029691..19029691
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a
Comments: Below Z93 > BY30941
Forward Primer: Y56311_F CCTCATTGAATTGTCATCGC
Reverse Primer: Y56311_R GGATATTTGGGTTACATCTAAGTTTTATCTAG
Reviews

Customers who bought this product also purchased
Y174532
Y174532
Z94
Z94
KMS133
KMS133
Y43850
Y43850
L657
L657
Y20787
Y20787
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies