Top » Catalog » SNPs » Y56311

$18.00

Y56311
[Y56311]

Y56311
hg38 Position: ChrY:19029691..19029691
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a
Comments: Below Z93 > BY30941
Forward Primer: Y56311_F CCTCATTGAATTGTCATCGC
Reverse Primer: Y56311_R GGATATTTGGGTTACATCTAAGTTTTATCTAG
Reviews

Customers who bought this product also purchased
Z2124
Z2124
YP1506
YP1506
YP1451
YP1451
R1a-Z93 Panel
R1a-Z93 Panel
YP5585
YP5585
YP5322
YP5322
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies