Top » Catalog » SNPs » Y56311

$18.00

Y56311
[Y56311]

Y56311
hg38 Position: ChrY:19029691..19029691
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a
Comments: Below Z93 > BY30941
Forward Primer: Y56311_F CCTCATTGAATTGTCATCGC
Reverse Primer: Y56311_R GGATATTTGGGTTACATCTAAGTTTTATCTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x J1-ZS1282 Panel
1 x Y179930
1 x A26793
1 x Y174532
1 x Y220418
1 x FT20095
1 x Y220386
$196.00
Haplogroup Info
Other products
Currencies