Top » Catalog » SNPs » DF96

$18.00

DF96
[DF96]

DF96
hg38 Position: ChrY:15623928..15623928
Ancestral: A
Derived: G
Reference: Grierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2
Comments: Aka S1809; found in L1+ samples. Recommend testing in Z304+L1-
Forward Primer: DF96_F AAAGTCACTCTAGTGTCTGAAGTGTG
Reverse Primer: DF96_R AACATACAGGTATAGCATTATGCCTC
Reviews

Customers who bought this product also purchased
Z159
Z159
Y3264
Y3264
Z383
Z383
L200
L200
FGC24039
FGC24039
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies