Top » Catalog » SNPs » FGC13326

$19.00

FGC13326
[FGC13326]

FGC13326
hg38 Position: ChrY:20444832..20444832
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2b
Comments: Below Z381. approx. DF96
Forward Primer: FGC13326_F GACCCCTTCTCTCTATCTTCCTAG
Reverse Primer: FGC13326_R CAGGGTACATTGACGTCTTGTG
Reviews

Customers who bought this product also purchased
A14207
A14207
BY128969
BY128969
FGC8410
FGC8410
FGC23212
FGC23212
Y130198
Y130198
Y128673
Y128673
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies