Top » Catalog » SNPs » FT148773

$18.00

FT148773
[FT148773]

FT148773
hg38 Position: ChrY:7023602..7023602
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT148773_F CATACCTTATGCAGTTTATAGATGCAG
Reverse Primer: FT148773_R AACAGTGTGTTGCTCTAGGTCAGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies