Top » Catalog » SNPs » PF3308

$18.00

PF3308
[PF3308]

PF3308
hg38 Position: ChrY:15373274..15373274
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: G
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF3308_F GTGAACTCCCTTTCACAATTACG
Reverse Primer: PF3308_R TTTTTTCTCGTATATTTGTTTAAGCTCC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies