Top » Catalog » SNPs » S25577

$18.00

S25577
[S25577]

S25577
hg38 Position: ChrY:21281636..21281636
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E
Comments: .
Forward Primer: S25577_F GCCACCAGGCTCAGCTAC
Reverse Primer: S25577_R GCTCCCTGTTCAATGGAATG
Reviews

Customers who bought this product also purchased
S19341
S19341
Y142744
Y142744
ZQ825
ZQ825
PH2180
PH2180
S2972
S2972
Y178742
Y178742
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies