Top » Catalog » SNPs » S25577

$18.00

S25577
[S25577]

S25577
hg38 Position: ChrY:21281636..21281636
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E
Comments: .
Forward Primer: S25577_F GCCACCAGGCTCAGCTAC
Reverse Primer: S25577_R GCTCCCTGTTCAATGGAATG
Reviews

Customers who bought this product also purchased
Y142744
Y142744
BY5500
BY5500
S2979
S2979
L241
L241
BY5677
BY5677
E1b-V13 Panel
E1b-V13 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies