Top » Catalog » SNPs » A28357

$18.00

A28357
[A28357]

A28357
hg38 Position: ChrY:12002637..12002637
Ancestral: C
Derived: T
Reference: YSEQ (2021)
ISOGG Haplogroup: N
Comments: .
Forward Primer: A28357_F TTCATCTTCCATCACTGATGGA
Reverse Primer: A28357_R CACCCCCAGCAGAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT102945
1 x Y216563
$36.00
Haplogroup Info
Other products
Currencies