Top » Catalog » SNPs » FT102945

$18.00

FT102945
[FT102945]

FT102945
hg38 Position: ChrY:19538205..19538205
Ancestral: G
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT102945_F TTAATAAACTGTGGTCCACCCAC
Reverse Primer: FT102945_R CTGATCTTGGCTCCCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies