Top » Catalog » SNPs » Y216563

$18.00

Y216563
[Y216563]

Y216563
hg38 Position: ChrY:6877034..6877034
Ancestral: A
Derived: T
Reference: YFull (2020)
ISOGG Haplogroup: E1b
Comments: Below M81 > M5043
Forward Primer: Y216563_F GGGTTCCACTCTTCTGCAAG
Reverse Primer: Y216563_R TTGGTGCATTGTGAGCCTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT102945
1 x Y216563
1 x FT102031
1 x MZ8
1 x FT334063
1 x FT101913
1 x A28359
1 x A28358
$144.00
Haplogroup Info
Other products
Currencies