Top » Catalog » SNPs » Y128375

$18.00

Y128375
[Y128375]

Y128375
hg38 Position: ChrY:16755666..16755666
Ancestral: G
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: Below M81 > Z5009
Forward Primer: Y128375_F GACTGCAGGTGTGCTCTACTACC
Reverse Primer: Y128375_R GAAAGAACATAATGGGAAGAAAAATC
Reviews

Customers who bought this product also purchased
MZ90
MZ90
M81
M81
MZ211
MZ211
FT270551
FT270551
MZ279
MZ279
E1b-L19 Panel
E1b-L19 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies