Top » Catalog » SNPs » Y128375

$18.00

Y128375
[Y128375]

Y128375
hg38 Position: ChrY:16755666..16755666
Ancestral: G
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: Below M81 > Z5009
Forward Primer: Y128375_F GACTGCAGGTGTGCTCTACTACC
Reverse Primer: Y128375_R GAAAGAACATAATGGGAAGAAAAATC
Reviews

Customers who bought this product also purchased
MZ90
MZ90
M81
M81
Z5009
Z5009
BY9671
BY9671
MZ131
MZ131
FT31300
FT31300
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR2
$25.00
Haplogroup Info
Other products
Currencies