Top » Catalog » SNPs » A26850

$18.00

A26850
[A26850]

A26850
hg38 Position: ChrY:22285964..22285964
Ancestral: T
Derived: C
Reference: YSEQ (2020)
ISOGG Haplogroup: E1b1
Comments: Below M81 > Z5009 > FT160111
Forward Primer: A26850_F ATGAAGATAATACCAGGTTCATGATTAC
Reverse Primer: A26850_R TGGTTTTGATTTGCATTTCTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A26850
1 x A4620
1 x A24110
1 x A28151
1 x A20569
1 x A27996
1 x A20412
1 x A27286
$144.00
Haplogroup Info
Other products
Currencies