Top » Catalog » SNPs » Z16246

$18.00

Z16246
[Z16246]

Z16246
hg38 Position: ChrY:16964698..16964698
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c2 (not listed)
Comments: downstream of DF63 > Z16245
Forward Primer: Z16246_F CAGTCCAGTGTGGATCGAAG
Reverse Primer: Z16246_R CCAAGTAGATCCCAATGTATGTTG
Reviews

Customers who bought this product also purchased
DF63
DF63
L21
L21
DF49
DF49
DF13
DF13
Z39589
Z39589
A91
A91
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies