Top » Catalog » SNPs » Z16246

$18.00

Z16246
[Z16246]

Z16246
hg38 Position: ChrY:16964698..16964698
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c2 (not listed)
Comments: downstream of DF63 > Z16245
Forward Primer: Z16246_F CAGTCCAGTGTGGATCGAAG
Reverse Primer: Z16246_R CCAAGTAGATCCCAATGTATGTTG
Reviews

Customers who bought this product also purchased
BY2583
BY2583
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
BY20329
BY20329
A5846
A5846
DF13
DF13
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies