Top » Catalog » SNPs » A7700

$18.00

A7700
[A7700]

A7700
hg38 Position: ChrY:7771437..7771437
Ancestral: T
Derived: C
Reference: Gary Yorke (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20561
Forward Primer: A7700_F GAGAGATGCCATAGTATTAGATTTTATGG
Reverse Primer: A7700_R CTGAGCGTAGTTTAATACTAGGATGTTC
Reviews

Customers who bought this product also purchased
A7705
A7705
R1b-FGC20561 Yorke Panel
R1b-FGC20561 Yorke Panel
A7704
A7704
A7706
A7706
A7709
A7709
A7703
A7703
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies