Top » Catalog » SNPs » A7701

$18.00

A7701
[A7701]

A7701
hg38 Position: ChrY:8337943..8337943
Ancestral: C
Derived: T
Reference: Gary Yorke (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20561
Forward Primer: A7701_F CCAGCATACTGGTGACATTGG
Reverse Primer: A7701_R CCTCTCTAGGCAAGGGCTAGG
Reviews

Customers who bought this product also purchased
A7708
A7708
A7702
A7702
A7707
A7707
A7700
A7700
A7705
A7705
R1b-FGC20561 Yorke Panel
R1b-FGC20561 Yorke Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies