Top » Catalog » SNPs » A7702

$18.00

A7702
[A7702]

A7702
hg38 Position: ChrY:13298023..13298023
Ancestral: G
Derived: C
Reference: Gary Yorke (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20561
Forward Primer: A7702_F CGTGCCATATTCCAGGAAAG
Reverse Primer: A7702_R CAAATGAAGGCCTTGAAAGG
Reviews

Customers who bought this product also purchased
A7704
A7704
A7706
A7706
A7709
A7709
A7703
A7703
A7708
A7708
A7701
A7701
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies