Top » Catalog » SNPs » A7704

$18.00

A7704
[A7704]

A7704
hg38 Position: ChrY:14288457..14288457
Ancestral: T
Derived: C
Reference: Gary Yorke (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20561
Forward Primer: A7704_F AGGGAGCACCAGGTGATAAG
Reverse Primer: A7704_R GCATTACTCACATCCAAAGTACAGAC
Reviews

Customers who bought this product also purchased
A7700
A7700
A7705
A7705
R1b-FGC20561 Yorke Panel
R1b-FGC20561 Yorke Panel
A7706
A7706
A7703
A7703
A7709
A7709
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies