Top » Catalog » SNPs » A7707

$18.00

A7707
[A7707]

A7707
hg38 Position: ChrY:19708038..19708038
Ancestral: T
Derived: G
Reference: Gary Yorke (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20561
Forward Primer: A7707_F GTCAGCAGTCCACCCTCG
Reverse Primer: A7707_R ACCTGGGTAGGAAGGAGAGG
Reviews

Customers who bought this product also purchased
R1b-FGC20561 Yorke Panel
R1b-FGC20561 Yorke Panel
A7706
A7706
A7703
A7703
A7709
A7709
A7702
A7702
A7708
A7708
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies