Top » Catalog » SNPs » A7708

$18.00

A7708
[A7708]

A7708
hg38 Position: ChrY:20754422..20754422
Ancestral: T
Derived: A
Reference: Gary Yorke (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20561
Forward Primer: A7708_F CAGGAGGGCACAGGAATTG
Reverse Primer: A7708_R TTGTAAGCGCGTAACAGTGC
Reviews

Customers who bought this product also purchased
R1b-FGC20561 Yorke Panel
R1b-FGC20561 Yorke Panel
A7706
A7706
A7703
A7703
A7709
A7709
A7702
A7702
A7707
A7707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies