Top » Catalog » SNPs » A7709

$18.00

A7709
[A7709]

A7709
hg38 Position: ChrY:20859007..20859007
Ancestral: C
Derived: T
Reference: Gary Yorke (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20561
Forward Primer: A7709_F ATGGGGTGTGGATAATACCG
Reverse Primer: A7709_R TTCCTCTCCTTGGCTACCAG
Reviews

Customers who bought this product also purchased
R1b-FGC20561 Yorke Panel
R1b-FGC20561 Yorke Panel
A7706
A7706
A7703
A7703
A7708
A7708
A7702
A7702
A7707
A7707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies