Top » Catalog » SNPs » A7709

$18.00

A7709
[A7709]

A7709
hg38 Position: ChrY:20859007..20859007
Ancestral: C
Derived: T
Reference: Gary Yorke (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC20561
Forward Primer: A7709_F ATGGGGTGTGGATAATACCG
Reverse Primer: A7709_R TTCCTCTCCTTGGCTACCAG
Reviews

Customers who bought this product also purchased
A7703
A7703
A7708
A7708
A7702
A7702
A7707
A7707
A7701
A7701
A7705
A7705
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies