Top » Catalog » SNPs » A7710

$18.00

A7710
[A7710]

A7710
hg38 Position: ChrY:16825231..16825231
Ancestral: G
Derived: A
Reference: Dug Garrett (2015)
ISOGG Haplogroup: E1a1a1b
Comments: Below Z36090
Forward Primer: A7710_F TGCTAGTAAATTCCAGTCAATTTGG
Reverse Primer: A7710_R CGTGATCCTCCTGCCTTG
Reviews

Customers who bought this product also purchased
CTS9548
CTS9548
M44
M44
Z17696
Z17696
E1a-M132 Panel
E1a-M132 Panel
Z31497
Z31497
Z17467
Z17467
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies