Top » Catalog » SNPs » Z1899

$18.00

Z1899
[Z1899]

Z1899
hg38 Position: ChrY:21222452..21222452
Ancestral: T
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: beneath DF27. parallel to Z195/Z196
Forward Primer: Z1899_F AAAAACCCCCAAGTGTATGC
Reverse Primer: Z1899_R CATGCATGATCTCCTCAGTGTC
Reviews

Customers who bought this product also purchased
A11625
A11625
BY129286
BY129286
A11632
A11632
BY16029
BY16029
BY21429
BY21429
Z29954
Z29954
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies