Top » Catalog » SNPs » Z35447

$18.00

Z35447
[Z35447]

Z35447
hg38 Position: ChrY:9017437..9017437
Ancestral: C
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a1a3a
Comments: subgrp under Z31464
Forward Primer: Z35447_F GCCCAGTAATTGAAACCTGATG
Reverse Primer: Z35447_R TCCAACTCCATCGCCAC
Reviews

Customers who bought this product also purchased
G Superclade Panel
G Superclade Panel
FGC750
FGC750
FGC715
FGC715
Z31470
Z31470
G2a-Z6552 Panel
G2a-Z6552 Panel
Z31475
Z31475
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies