Top » Catalog » SNPs » FGC22516

$18.00

FGC22516
[FGC22516]

FGC22516
hg38 Position: ChrY:10006026..10006026
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1a~
Comments: Below L2
Forward Primer: FGC22516_F ACAGAAATTATTCCTTAGTTTTAGATTGC
Reverse Primer: FGC22516_R GAGCTTTCTGATCTTGCTTCG
Reviews

Customers who bought this product also purchased
FGC53427
FGC53427
FGC53426
FGC53426
FGC52322
FGC52322
FGC52320
FGC52320
FGC52326
FGC52326
FGC52317
FGC52317
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies