Top » Catalog » SNPs » FGC22516

$18.00

FGC22516
[FGC22516]

FGC22516
hg38 Position: ChrY:10006026..10006026
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1a~
Comments: Below L2
Forward Primer: FGC22516_F ACAGAAATTATTCCTTAGTTTTAGATTGC
Reverse Primer: FGC22516_R GAGCTTTCTGATCTTGCTTCG
Reviews

Customers who bought this product also purchased
FGC52322
FGC52322
FGC52320
FGC52320
FGC52326
FGC52326
FGC52317
FGC52317
FGC53430
FGC53430
R1b-FGC22516 Panel
R1b-FGC22516 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies