Top » Catalog » SNPs » FGC22533

$18.00

FGC22533
[FGC22533]

FGC22533
hg38 Position: ChrY:14180261..14180261
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1a~
Comments: Below L2
Forward Primer: FGC22533_F TGCTTTAACAATTCATACAGGGG
Reverse Primer: FGC22533_R TGATGTTCAGTCAATTTGGAGC
Reviews

Customers who bought this product also purchased
R1b-FGC22538 Panel
R1b-FGC22538 Panel
FGC22512
FGC22512
FGC22541
FGC22541
FGC22523
FGC22523
FGC22500
FGC22500
FGC22529
FGC22529
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies