Top » Catalog » SNPs » Y6644

$18.00

Y6644
[Y6644]

Y6644
hg38 Position: ChrY:13842873..13842873
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a3 (not listed)
Comments: Below L1317 > Y6647.
Forward Primer: Y6644_F TCGTAAGGCCAGTCTTCTGTC
Reverse Primer: Y6644_R TTATCCAGTCTTGGGCAGTTC
Reviews

Customers who bought this product also purchased
M253
M253
Y61120
Y61120
I2a-CTS10100 Panel
I2a-CTS10100 Panel
CTS1977
CTS1977
P38
P38
Y6647
Y6647
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies